Snappy Turtle Genome Viewer

A Visual Studio Code extension for viewing DNA sequences from FASTA files in a readable, organized format.

Snappy Turtle Genome Viewer aims to make genome sequence visualization easier by bringing FASTA file viewing into your VS Code workflow.

Features

• Open FASTA Files: Select and open genome sequence files directly from VS Code.
• FASTA Parsing: Read FASTA headers and DNA sequences.
• Genome Indexing: Track sequence records, their lengths, and line positions for efficient navigation.
• Horizontal Sequence Display: View DNA sequences in organized rows.

Supported File Formats

The extension is intended to work with common FASTA file extensions:

• .fa
• .fasta
• .fna
• .fas

What Is FASTA?

FASTA is a text-based format used to represent nucleotide or protein sequences.

A typical DNA FASTA file looks like this:

>Example_Genome
ATGCGTACGTAGCTAGCTAG
GCTAGCTAGCATCGATCGTA

Lines beginning with > contain sequence headers. The following lines contain the corresponding biological sequence.

Snappy Turtle Genome Viewer reads FASTA records to help organize and display this information.

Development

This extension is built using:

• TypeScript — extension logic and genome processing.
• Visual Studio Code Extension API — integration with VS Code.
• Node.js and npm — development environment and dependency management.